si:dkey-30j22.1

Ensembl ID:
ENSDARG00000042829
ZFIN ID:
ZDB-GENE-041001-184
Description:
Novel EGF domain containing protein [Source:UniProtKB/TrEMBL;Acc:Q5RGN7]
Human Orthologue:
LTBP3
Human Description:
latent transforming growth factor beta binding protein 3 [Source:HGNC Symbol;Acc:6716]
Mouse Orthologue:
Ltbp3
Mouse Description:
latent transforming growth factor beta binding protein 3 Gene [Source:MGI Symbol;Acc:MGI:1101355]

Alleles

There are 12 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa43498 Nonsense Mutation detected in F1 DNA During 2018
sa32310 Essential Splice Site Available for shipment Available now
sa37112 Essential Splice Site Mutation detected in F1 DNA During 2018
sa45711 Essential Splice Site Mutation detected in F1 DNA During 2018
sa9525 Essential Splice Site Available for shipment Available now
sa18326 Essential Splice Site Available for shipment Available now
sa43497 Nonsense Mutation detected in F1 DNA During 2018
sa39295 Essential Splice Site Mutation detected in F1 DNA During 2018
sa43496 Nonsense Mutation detected in F1 DNA During 2018
sa29418 Essential Splice Site Mutation detected in F1 DNA During 2018
sa39294 Essential Splice Site Mutation detected in F1 DNA During 2018
sa44946 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa43498
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062833   None 1075 None 22
ENSDART00000134959 Nonsense 726 8328 15 167
Genomic Location (Zv9):
Chromosome 20 (position 35717880)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 35790393
GRCz11 20 35693272
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTTCAGTAAATTATATTTCATTTGTTTCTCTAATAGATGTAGATGAATG[T/A]CTGTTCAGTCTGCCTGTCTGTGGTCCATATTCCAACTGCACAAATGAAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32310
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062833   None 1075 None 22
ENSDART00000134959 Essential Splice Site 770 8328 15 167
Genomic Location (Zv9):
Chromosome 20 (position 35717746)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 35790259
GRCz11 20 35693138
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACTACAGCAAACTCCAATTTCACCATCAGCATCAACAACACATGTGAAG[G/A]TAAATTCTTGCATGGGATTTGTATGTAGTTTTGGAAATTAATTTAGCATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37112
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062833 Essential Splice Site 43 1075 None 22
ENSDART00000134959 Essential Splice Site 5746 8328 None 167
Genomic Location (Zv9):
Chromosome 20 (position 35640895)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 35713408
GRCz11 20 35616287
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATGTAACTGACCCAAACCTCCCTATAAACAGCAGTAACACATGCACAGG[T/G]AAGACTGAAGCTCTGAACAGTATATTTCTATATGTACTTCCTAAGTTGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45711
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062833   None 1075 None 22
ENSDART00000134959 Essential Splice Site 5795 8328 115 167
Genomic Location (Zv9):
Chromosome 20 (position 35640545)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 35713058
GRCz11 20 35615937
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTGCAACAAACTCAAATCTCACCATCAGCAACGACAACACATGCAGAGG[T/C]GCATTAAATATTTTCATTTTTGTTAATTCTAAAATTTGTTAAAAATTGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9525
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062833   None 1075 None 22
ENSDART00000134959 Essential Splice Site 6039 8328 120 167
Genomic Location (Zv9):
Chromosome 20 (position 35638369)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 35710882
GRCz11 20 35613761
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CACTGCAACAAACTCAAATCTCACCATCAGCAACGACAACACATGCAGAG[G/A]TACATCTTTATATTTTAAWTTTTGTTAAATATAAATTAAAGAGTTTGTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18326
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062833   None 1075 None 22
ENSDART00000134959 Essential Splice Site 6089 8328 121 167
Genomic Location (Zv9):
Chromosome 20 (position 35638064)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 35710577
GRCz11 20 35613456
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AATGTAACTGATCCAAACCTCCCTATAAACAGCAGTAACACATGCACAGG[T/C]ATGATTGACAGAAGCTCTGAGCAATTACTTTTCTGCATTCTCTTGCAACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43497
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062833   None 1075 None 22
ENSDART00000134959 Nonsense 6167 8328 123 167
Genomic Location (Zv9):
Chromosome 20 (position 35637214)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 35709727
GRCz11 20 35612606
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCATACTCCAACTGCACTAATGAAATAGGAAGCTACAATTGCTCATGTT[T/A]GGATGGATTCACTGCAACAAACTCAAATCTCACCATCAGCATCAACAACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39295
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062833   None 1075 None 22
ENSDART00000134959 Essential Splice Site 6333 8328 126 167
Genomic Location (Zv9):
Chromosome 20 (position 35636258)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 35708771
GRCz11 20 35611650
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAATGTATCAGAGCCAAACCTCCCTATAAACAGCAATAACACATGCACAG[G/A]TATGACTGACAGATGAAGCTCTGAGCAATTACTTTTCATGCTTTTCGCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43496
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062833 Nonsense 284 1075 6 22
ENSDART00000134959 Nonsense 6722 8328 134 167
Genomic Location (Zv9):
Chromosome 20 (position 35631407)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 35703920
GRCz11 20 35606799
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCTCAGCGGATATAATGCAACTGATCCTATAAGCAGCAGTAACCCATGC[A/T]GAGGTATGACTGTCAGATAAAACCCTGAACTGTTTATGTTTAATTGTATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa29418
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062833 Essential Splice Site 968 1075 20 22
ENSDART00000134959 Essential Splice Site 7553 8328 151 167
Genomic Location (Zv9):
Chromosome 20 (position 35622622)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 35695135
GRCz11 20 35598014
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATGTATCAGATCCAAACCTCCCTATAAACAGCAATAACACATGCACAGG[T/C]ATGATTGACAGATGAAGCAGTTTTTACTGTTTGTATTATTAAATACTGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39294
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062833   None 1075 None 22
ENSDART00000134959 Essential Splice Site 7748 8328 155 167
Genomic Location (Zv9):
Chromosome 20 (position 35619849)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 35692362
GRCz11 20 35595241
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAATGTATCTGATCCAAACCTCCCTATAAACAGCAATAACACATGCACAG[G/T]TATGATTGACAGATGAAGCACTGGACAGTTTGTGACTGTTTGTATTTCCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44946
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062833   None 1075 None 22
ENSDART00000134959 Nonsense 7802 8328 157 167
Genomic Location (Zv9):
Chromosome 20 (position 35618947)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 35691460
GRCz11 20 35594339
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCATTATTACATATTTTAATATATTTTCCCTATTAGATGTCAATGAATG[T/A]CTGTTCAGTCCATCAGTCTGTGGTCCAAACTCCAATTGCACTAATGAAAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link