
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
egr2b
- Ensembl ID:
- ENSDARG00000042826
- ZFIN ID:
- ZDB-GENE-980526-283
- Description:
- Early growth response protein 2b [Source:UniProtKB/Swiss-Prot;Acc:Q05159]
- Human Orthologue:
- EGR2
- Human Description:
- early growth response 2 [Source:HGNC Symbol;Acc:3239]
- Mouse Orthologue:
- Egr2
- Mouse Description:
- early growth response 2 Gene [Source:MGI Symbol;Acc:MGI:95296]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa10063 | Nonsense | Available for shipment | Available now |
sa18210 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa10063
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > G
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000062855 | Nonsense | 41 | 412 | 1 | 2 |
ENSDART00000135865 | None | 232 | None | 2 | |
ENSDART00000062855 | Nonsense | 41 | 412 | 1 | 2 |
ENSDART00000135865 | None | 232 | None | 2 |
- Genomic Location (Zv9):
- Chromosome 12 (position 9240258)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 12 8448213 GRCz11 12 8486056 - KASP Assay ID:
- 2260-4984.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TATTCGGTGGACGAGCTTGSCACAACACTGCCAGCCTCTGTGACTATATA[T/G]AACGATTTAGGAGGACATTACGAGCAGATAAACGYAGGAGGTAAGAACGA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa18210
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > G
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000062855 | Nonsense | 41 | 412 | 1 | 2 |
ENSDART00000135865 | None | 232 | None | 2 | |
ENSDART00000062855 | Nonsense | 41 | 412 | 1 | 2 |
ENSDART00000135865 | None | 232 | None | 2 |
- Genomic Location (Zv9):
- Chromosome 12 (position 9240258)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 12 8448213 GRCz11 12 8486056 - KASP Assay ID:
- 2260-4984.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TATTCGGTGGWCGAGCTTGSCACAACACTGCCAGCCTCTGTGACTATATA[T/G]AACGATTTAGGAGGACATTACGAGCAGATAAACGYAGGAGGTAAGAACGA
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Atopic dermatitis: Genome-wide association study identifies eight new susceptibility loci for atopic dermatitis in the Japanese population. (View Study)
- Ewing sarcoma: Common variants near TARDBP and EGR2 are associated with susceptibility to Ewing sarcoma. (View Study)
- Temperament: A genome-wide meta-analysis of association studies of Cloninger's Temperament Scales. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
OMIM
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: