spcs2

Ensembl ID:
ENSDARG00000042823
ZFIN ID:
ZDB-GENE-050320-32
Description:
Probable signal peptidase complex subunit 2 [Source:UniProtKB/Swiss-Prot;Acc:Q5BJI9]
Human Orthologue:
SPCS2
Human Description:
signal peptidase complex subunit 2 homolog (S. cerevisiae) [Source:HGNC Symbol;Acc:28962]
Mouse Orthologue:
Spcs2
Mouse Description:
signal peptidase complex subunit 2 homolog (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:1913874]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa11413 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa11413
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062852 Nonsense 135 203 4 5
ENSDART00000142995 Nonsense 133 201 4 5
Genomic Location (Zv9):
Chromosome 15 (position 4856292)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 5006345
GRCz11 15 4997492
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGGCCATGCAGAAGGACCCAGCAGGAATGGACCCAGATCACARTTGGTG[T/A]CTGTCCTCCAGCCTAAAAAGGTAAATAGGTTTTATAGTAGTGAGTTTTAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link