zgc:123272

Ensembl ID:
ENSDARG00000042727
ZFIN ID:
ZDB-GENE-051113-108
Description:
defects in morphology protein 1 homolog [Source:RefSeq peptide;Acc:NP_001032490]
Human Orthologue:
DEM1
Human Description:
defects in morphology 1 homolog (S. cerevisiae) [Source:HGNC Symbol;Acc:26115]
Mouse Orthologue:
Dem1
Mouse Description:
defects in morphology 1 homolog (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:1920422]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa39046 Essential Splice Site Mutation detected in F1 DNA During 2018
sa10418 Nonsense Available for shipment Available now
sa10566 Nonsense Available for shipment Available now
sa10679 Nonsense Available for shipment Available now
sa39045 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa39046
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062695 Essential Splice Site 12 229 1 6
ENSDART00000129154   None 394 None 6

The following transcripts of ENSDARG00000042727 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 15 (position 24447191)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 25158378
GRCz11 15 25093643
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAGTTTGTTGTGAATGTGGTCATGTGACTTTATTTTCTGGACACAAGCGG[G/T]TATTGTTGAGTTATATAAGTGTTCGTGTCTCATCTTTTTTCTTCCATGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10418
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062695 Nonsense 228 229 6 6
ENSDART00000129154   None 394 None 6
ENSDART00000062695 Nonsense 228 229 6 6
ENSDART00000129154   None 394 None 6
ENSDART00000062695 Nonsense 228 229 6 6
ENSDART00000129154   None 394 None 6

The following transcripts of ENSDARG00000042727 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 15 (position 24440761)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 25151948
GRCz11 15 25087213
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TYATGTCTTTCGTCTGTTTTCAGGGTTTTTTTCTTGTAAGGCAMGGCTTT[C/T]GAAAATGATGAYATGAGACTCTGCTGGGTAGCTGCGCTGGTTTACTAACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10566
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062695 Nonsense 228 229 6 6
ENSDART00000129154   None 394 None 6
ENSDART00000062695 Nonsense 228 229 6 6
ENSDART00000129154   None 394 None 6
ENSDART00000062695 Nonsense 228 229 6 6
ENSDART00000129154   None 394 None 6

The following transcripts of ENSDARG00000042727 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 15 (position 24440761)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 25151948
GRCz11 15 25087213
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TYATGTCTTTCGTCTGTTTTCAGGGTTTTTTTCTTGTAAGGCAMGGCTTT[C/T]GAAAATGATGAYATGAGACTCTGCTGGGTAGCTGCGCTGGTTTACTAACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10679
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062695 Nonsense 228 229 6 6
ENSDART00000129154   None 394 None 6
ENSDART00000062695 Nonsense 228 229 6 6
ENSDART00000129154   None 394 None 6
ENSDART00000062695 Nonsense 228 229 6 6
ENSDART00000129154   None 394 None 6

The following transcripts of ENSDARG00000042727 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 15 (position 24440761)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 25151948
GRCz11 15 25087213
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TYATGTCTTTCGTCTGTTTTCAGGGTTTTTTTCTTGTAAGGCAMGGCTTT[C/T]GAAAATGATGAYATGAGACTCTGCTGGGTAGCTGCGCTGGTTTACTAACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39045
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062695   None 229 None 6
ENSDART00000129154 Nonsense 244 394 6 6

The following transcripts of ENSDARG00000042727 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 15 (position 24439108)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 25150295
GRCz11 15 25085560
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TACATCTGTTCTAAAACATGCATCTATTACTCAGGTGGGCCTGTATAAAT[T/A]GCTCTTTGATGGACTGGTCAGAGGGGAGATGAAAAAAAATCACATTTTCG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link