supt5h

Ensembl ID:
ENSDARG00000042724
ZFIN ID:
ZDB-GENE-001207-1
Description:
Transcription elongation factor SPT5 [Source:UniProtKB/Swiss-Prot;Acc:Q9DDT5]
Human Orthologue:
SUPT5H
Human Description:
suppressor of Ty 5 homolog (S. cerevisiae) [Source:HGNC Symbol;Acc:11469]
Mouse Orthologue:
Supt5h
Mouse Description:
suppressor of Ty 5 homolog (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:1202400]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa42529 Essential Splice Site Mutation detected in F1 DNA During 2018
sa13309 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa42529
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062674   None 855 None 23
ENSDART00000062676 Essential Splice Site 105 1084 5 30
Genomic Location (Zv9):
Chromosome 15 (position 19333190)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 20435816
GRCz11 15 20371548
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTGCCTTTCTTCCTTCCTCAACGCTGGATCTGAGCAGAAGAGGCTGAAG[G/A]TATGTGCTTAAATCTTCTGGAGTGCATGGATATTTGTTTTTTTGTCAAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13309
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062674 Nonsense 222 855 10 23
ENSDART00000062676 Nonsense 223 1084 11 30
Genomic Location (Zv9):
Chromosome 15 (position 19335962)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 20438588
GRCz11 15 20374320
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGCCACTTCAAAWCAAATCAGTAGTTGCCCCTGAACATGTCAAAGGTTA[T/A]ATCTATGTGGAGGCGTACAAGCAGACCCAYGTCAAGGCTGCCATTGAGGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link