zbtb37

Ensembl ID:
ENSDARG00000042689
ZFIN ID:
ZDB-GENE-050208-621
Description:
zinc finger and BTB domain-containing protein 37 [Source:RefSeq peptide;Acc:NP_001038625]
Human Orthologue:
ZBTB37
Human Description:
zinc finger and BTB domain containing 37 [Source:HGNC Symbol;Acc:28365]
Mouse Orthologue:
Zbtb37
Mouse Description:
zinc finger and BTB domain containing 37 Gene [Source:MGI Symbol;Acc:MGI:2444467]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa13160 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa13160
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062629 Nonsense 262 521 1 3
Genomic Location (Zv9):
Chromosome 22 (position 16179512)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 16007082
GRCz11 22 16033352
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGCGGATGGTTGATGGGTTTCGGATTAAGRCAGAAAGGATGGATGAGTG[G/A]ATGGGGGCRGAGACCCAGGCTTCAGCGGAGGAAGGCAGTGGGGCAGAGGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link