
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
zbtb37
- Ensembl ID:
- ENSDARG00000042689
- ZFIN ID:
- ZDB-GENE-050208-621
- Description:
- zinc finger and BTB domain-containing protein 37 [Source:RefSeq peptide;Acc:NP_001038625]
- Human Orthologue:
- ZBTB37
- Human Description:
- zinc finger and BTB domain containing 37 [Source:HGNC Symbol;Acc:28365]
- Mouse Orthologue:
- Zbtb37
- Mouse Description:
- zinc finger and BTB domain containing 37 Gene [Source:MGI Symbol;Acc:MGI:2444467]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa13160 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa13160
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- G > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000062629 | Nonsense | 262 | 521 | 1 | 3 |
- Genomic Location (Zv9):
- Chromosome 22 (position 16179512)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 22 16007082 GRCz11 22 16033352 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- GTGCGGATGGTTGATGGGTTTCGGATTAAGRCAGAAAGGATGGATGAGTG[G/A]ATGGGGGCRGAGACCCAGGCTTCAGCGGAGGAAGGCAGTGGGGCAGAGGA
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: