si:dkeyp-192m14.7

Ensembl ID:
ENSDARG00000042670
ZFIN ID:
ZDB-GENE-060503-274
Description:
Novel protein similar to vertebrate epidermal growth factor receptor pathway substrate 15 (EP15) [So
Human Orthologue:
EPS15L1
Human Description:
epidermal growth factor receptor pathway substrate 15-like 1 [Source:HGNC Symbol;Acc:24634]
Mouse Orthologue:
Eps15l1
Mouse Description:
epidermal growth factor receptor pathway substrate 15-like 1 Gene [Source:MGI Symbol;Acc:MGI:104582]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24121 Nonsense Available for shipment Available now
sa14244 Nonsense Available for shipment Available now
sa43801 Nonsense Mutation detected in F1 DNA During 2018
sa820 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa24121
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080047 Nonsense 295 929 10 26
Genomic Location (Zv9):
Chromosome 22 (position 16092724)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 15920294
GRCz11 22 15946564
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCGGTTGCAGACAGGGGGCGCTATGATGACATCTTCCTCAAAACAGACT[C/A]AGATCTGGATGGTTTCGTCAGCGGACTAGAAGTTAAAGACATCTTCATGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14244
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080047 Nonsense 345 929 11 26
Genomic Location (Zv9):
Chromosome 22 (position 16092493)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 15920063
GRCz11 22 15946333
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACCAGGCAGATGGGCAAACTCACACGCGAGCAGTTCTCCTTAGCCATGTA[T/A]CTAATTCAGCAGAAAGTGAGCAAAGGTCTGGATCCTCCGCAGGCTTTGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43801
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080047 Nonsense 671 929 19 26
Genomic Location (Zv9):
Chromosome 22 (position 16078515)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 15906085
GRCz11 22 15932355
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCACACAGACCCCTTCCAGTCTGAAGACCCCTTTAAAACAGACCCTTTC[A/T]AAGGTTTGTCATGGCTGTTTCCTTTTCTTTTTCTTCTTTTAAACTTATTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa820
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080047 Essential Splice Site 813 929 24 26
Genomic Location (Zv9):
Chromosome 22 (position 16071789)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 15899359
GRCz11 22 15925629
KASP Assay ID:
554-0724.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCACTCCCGCCCAAAAAAAGTATACCACCACGACCCAAACCACCCAGCGG[T/C]AAGACTTTAAGAGRCACACAAACAAACTGTGACAAAATTTATATACACAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link