zgc:110348

Ensembl ID:
ENSDARG00000042661
ZFIN IDs:
ZDB-GENE-050417-317, ZDB-GENE-061013-348, ZDB-GENE-061013-348, ZDB-GENE-071004-107, ZDB-GENE-071004-107
Description:
hypothetical protein LOC100126119 [Source:RefSeq peptide;Acc:NP_001103317]
Human Orthologue:
TSTA3
Human Description:
tissue specific transplantation antigen P35B [Source:HGNC Symbol;Acc:12390]
Mouse Orthologue:
Tsta3
Mouse Description:
tissue specific transplantation antigen P35B Gene [Source:MGI Symbol;Acc:MGI:98857]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15220 Nonsense Available for shipment Available now
sa16508 Essential Splice Site Available for shipment Available now
sa29465 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa15220
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062578   None 241 2 11
ENSDART00000100262 Nonsense 66 354 2 10
ENSDART00000100267 Nonsense 32 320 2 10

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 20 (position 49138937)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 48914345
GRCz11 20 48745562
KASP Assay ID:
2261-4946.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCAGTGGGCTGGTGGGGCGAGCCATAKAGCGGGTGGTGAAAGAGGAGGGC[A/T]GAGRAGGAGAAGAATGGACATTCCTSTCATCCAAAGAWGCCAATCTTTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16508
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062578 Essential Splice Site 84 241 5 11
ENSDART00000100262 Essential Splice Site 188 354 5 10
ENSDART00000100267 Essential Splice Site 154 320 5 10
Genomic Location (Zv9):
Chromosome 20 (position 49119346)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 48933936
GRCz11 20 48765153
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTAATTTYGGTTATGCCTTYGCCAARCGCATGATTGATGTCCAAAACAGG[T/C]YAGAAACAGGTTTAAAGCATGTATGCCYCACATGAAAGCATATCTGGRTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa29465
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062578 Essential Splice Site 129 241 None 11
ENSDART00000100262 Essential Splice Site 233 354 None 10
ENSDART00000100267 Essential Splice Site 199 320 None 10
Genomic Location (Zv9):
Chromosome 20 (position 49114970)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 48938312
GRCz11 20 48769529
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAAGCTGAGCTCTCTTTTTGATACTAACCATTTGTGCCTGTGTGTCTTGT[A/G]GAGGAAGGTAAACCTCTGCAGGTCTGGGGTTCAGGGAAACCTCTGCGTCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link