wtap

Ensembl ID:
ENSDARG00000042642
ZFIN ID:
ZDB-GENE-030131-5990
Description:
Pre-mRNA-splicing regulator WTAP [Source:UniProtKB/Swiss-Prot;Acc:Q7SXL7]
Human Orthologue:
WTAP
Human Description:
Wilms tumor 1 associated protein [Source:HGNC Symbol;Acc:16846]
Mouse Orthologues:
Gm7381, Wtap
Mouse Descriptions:
predicted gene 7381 Pseudogene [Source:MGI Symbol;Acc:MGI:3643743]
Wilms' tumour 1-associating protein Gene [Source:MGI Symbol;Acc:MGI:1926395]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa32300 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa32300
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062552 Essential Splice Site 49 423 4 8
ENSDART00000147359 Essential Splice Site 49 151 4 6
Genomic Location (Zv9):
Chromosome 20 (position 30962828)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 31034041
GRCz11 20 30936920
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATGAAACTTACGTCCAGATGCTTGAGGCGAAATATGCTGATTTAAACTG[T/A]AAGTATGCACATCTTAAATGTTCTGAATAATTCATAGTCTTGAGTGCTTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link