
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
tert
- Ensembl ID:
- ENSDARG00000042637
- ZFIN IDs:
- ZDB-GENE-080405-1, ZDB-GENE-080405-1
- Description:
- telomerase reverse transcriptase [Source:RefSeq peptide;Acc:NP_001077335]
- Human Orthologue:
- TERT
- Human Description:
- telomerase reverse transcriptase [Source:HGNC Symbol;Acc:11730]
- Mouse Orthologue:
- Tert
- Mouse Description:
- telomerase reverse transcriptase Gene [Source:MGI Symbol;Acc:MGI:1202709]
Alleles
There are 3 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
hu3430 | Nonsense | Available for shipment | Available now |
sa25076 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa6541 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- hu3430
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000098884 | Nonsense | 156 | 1088 | 3 | 19 |
ENSDART00000098893 | Nonsense | 164 | 1098 | 2 | 16 |
- Genomic Location (Zv9):
- Chromosome 19 (position 608257)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 19 629744 GRCz11 19 629553 - KASP Assay ID:
- 554-0052.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CGGTACCTGCTGCAGGACTGTGCCGTTTTCACCACCGTCCCGCCATCGTG[T/A]GTTCTGCAGGTGTGCGGAGAACCTGTTTACGACTTGCTGATGCCGCGCTC
- Associated Phenotype:
Normal
Stage Entity Quality Tag Larval:Day 5
ZFS:0000037whole organism
ZFA:0001094quality
PATO:0000001normal
PATO:0000461
Mutation Details
- Allele Name:
- sa25076
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000098884 | Nonsense | 231 | 1088 | 3 | 19 |
ENSDART00000098893 | Nonsense | 239 | 1098 | 2 | 16 |
- Genomic Location (Zv9):
- Chromosome 19 (position 608480)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 19 629967 GRCz11 19 629776 - KASP Assay ID:
- 554-7560.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ATATTTCGGTAAAGCGGCGGAGGGTAAAGGAAACTGTGAATAATAATAAC[G/T]GAAATTACAGATCTCGGTGTTTTGCAATTTCTAAAAAGAGAGCGAGAGAT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa6541
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000098884 | Nonsense | 440 | 1088 | 3 | 19 |
ENSDART00000098893 | Nonsense | 448 | 1098 | 2 | 16 |
- Genomic Location (Zv9):
- Chromosome 19 (position 609109)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 19 630596 GRCz11 19 630405 - KASP Assay ID:
- 554-4929.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- RAGGATATGGAGTCTCTGCTGAAGTCACACTCGTCTCCWTATAGAGTTTA[T/A]CTGTTYGTCAGGGAGTGTCTGCGCYATATTATTCCCCACGAGCTCTGGGG
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Bladder cancer: A multi-stage genome-wide association study of bladder cancer identifies multiple susceptibility loci. (View Study)
- Breast cancer: A common variant at the TERT-CLPTM1L locus is associated with estrogen receptor-negative breast cancer. (View Study)
- Glioma: Chromosome 7p11.2 (EGFR) variation influences glioma risk. (View Study)
- Glioma: Combinations of newly confirmed Glioma-Associated loci link regions on chromosomes 1 and 9 to increased disease risk. (View Study)
- Glioma: Genome-wide association study identifies five susceptibility loci for glioma. (View Study)
- Glioma: Genome-wide association study of glioma and meta-analysis. (View Study)
- Idiopathic pulmonary fibrosis: A genome-wide association study identifies an association of a common variant in TERT with susceptibility to idiopathic pulmonary fibrosis. (View Study)
- Lung adenocarcinoma: A genome-wide association study identifies two new susceptibility loci for lung adenocarcinoma in the Japanese population. (View Study)
- Lung adenocarcinoma: A genome-wide association study of lung cancer identifies a region of chromosome 5p15 associated with risk for adenocarcinoma. (View Study)
- Lung adenocarcinoma: The 5p15.33 locus is associated with risk of lung adenocarcinoma in never-smoking females in Asia. (View Study)
- Lung adenocarcinoma: Variation in TP63 is associated with lung adenocarcinoma susceptibility in Japanese and Korean populations. (View Study)
- Lung cancer: A genome-wide association study identifies two new lung cancer susceptibility loci at 13q12.12 and 22q12.2 in Han Chinese. (View Study)
- Lung cancer: Genome-wide association analysis identifies new lung cancer susceptibility loci in never-smoking women in Asia. (View Study)
- Lung cancer: Lung cancer susceptibility locus at 5p15.33. (View Study)
- Melanoma: Genome-wide association study identifies three new melanoma susceptibility loci. (View Study)
- Prostate cancer: Seven prostate cancer susceptibility loci identified by a multi-stage genome-wide association study. (View Study)
- Prostate-specific antigen levels: Genetic correction of PSA values using sequence variants associated with PSA levels. (View Study)
- Testicular germ cell cancer: Variants near DMRT1, TERT and ATF7IP are associated with testicular germ cell cancer. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: