uchl5

Ensembl ID:
ENSDARG00000042635
ZFIN ID:
ZDB-GENE-040426-2051
Description:
ubiquitin carboxyl-terminal hydrolase isozyme L5 [Source:RefSeq peptide;Acc:NP_998249]
Human Orthologue:
UCHL5
Human Description:
ubiquitin carboxyl-terminal hydrolase L5 [Source:HGNC Symbol;Acc:19678]
Mouse Orthologue:
Uchl5
Mouse Description:
ubiquitin carboxyl-terminal esterase L5 Gene [Source:MGI Symbol;Acc:MGI:1914848]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa43846 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa43846
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105644 Nonsense 64 217 3 8
Genomic Location (Zv9):
Chromosome 22 (position 23578895)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 24202961
GRCz11 22 24229525
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGGATGCTTTTCATTTTGTGAGCTATGTTCCAGTTAATGGACGACTGTA[T/A]GAGTTGGACGGACTTCGTGAAGGACCAATAGATTTGGGTAGATTTGAAAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link