zgc:123246

Ensembl ID:
ENSDARG00000042561
ZFIN IDs:
ZDB-GENE-051120-99, ZDB-GENE-051120-99
Description:
hypothetical protein LOC567956 [Source:RefSeq peptide;Acc:NP_001032783]
Human Orthologue:
LPAR2
Human Description:
lysophosphatidic acid receptor 2 [Source:HGNC Symbol;Acc:3168]
Mouse Orthologue:
Lpar2
Mouse Description:
lysophosphatidic acid receptor 2 Gene [Source:MGI Symbol;Acc:MGI:1858422]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa19638 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa19638
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062426 Nonsense 185 369 3 7
ENSDART00000111243 Nonsense 185 369 2 6
Genomic Location (Zv9):
Chromosome 1 (position 59950585)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 58427763
GRCz11 1 59204643
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCGACATCGGGAACTGCTCCACAATGGCGCCGCTCTACAGCCGCAGCTA[T/A]CTGGTGTTCTGGGCCGCCATCAACCTGCTGACCTTCACCGTGATGGTGGC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Sphingolipid levels: Genome-wide association study identifies novel loci associated with circulating phospho- and sphingolipid concentrations. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link