zgc:110003

Ensembl ID:
ENSDARG00000042548
ZFIN ID:
ZDB-GENE-050522-121
Description:
tumor protein D52-like 1 [Source:RefSeq peptide;Acc:NP_001018570]
Human Orthologue:
TPD52L1
Human Description:
tumor protein D52-like 1 [Source:HGNC Symbol;Acc:12006]
Mouse Orthologue:
Tpd52l1
Mouse Description:
tumor protein D52-like 1 Gene [Source:MGI Symbol;Acc:MGI:1298386]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa10547 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa10547
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062402 Nonsense 55 189 3 6
ENSDART00000101047 Nonsense 92 131 5 8
ENSDART00000101049 Nonsense 68 160 3 5
ENSDART00000137485 Nonsense 93 132 5 5
Genomic Location (Zv9):
Chromosome 20 (position 39738940)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 39810596
GRCz11 20 39713231
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTTGTCTTATTTTTGTTGTCAGTTAGAAGAAGAAATCACTACTTTGAAA[C/T]AAGTCCTGGCCTCCAAAGAGAAGCGTCACTTGGAGTTGAAACAGAAACTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link