
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
si:dkey-251i10.3
- Ensembl ID:
- ENSDARG00000042520
- ZFIN ID:
- ZDB-GENE-060526-271
- Description:
- Novel protein similar to vertebrate UTP14, U3 small nucleolar ribonucleoprotein, homolog A (Yeast) (
- Human Orthologues:
- AL139082.1, UTP14A, UTP14C
- Human Descriptions:
- U3 small nucleolar RNA-associated protein 14 homolog C [Source:UniProtKB/Swiss-Prot;Acc:Q5TAP6]
- UTP14, U3 small nucleolar ribonucleoprotein, homolog A (yeast) [Source:HGNC Symbol;Acc:10665]
- UTP14, U3 small nucleolar ribonucleoprotein, homolog C (yeast) [Source:HGNC Symbol;Acc:20321]
- Mouse Orthologues:
- Utp14a, Utp14b
- Mouse Descriptions:
- UTP14, U3 small nucleolar ribonucleoprotein, homolog A (yeast) Gene [Source:MGI Symbol;Acc:MGI:19198
- UTP14, U3 small nucleolar ribonucleoprotein, homolog B (yeast) Gene [Source:MGI Symbol;Acc:MGI:24450
Alleles
There are 4 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa40599 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
sa20585 | Nonsense | Available for shipment | Available now |
sa20584 | Essential Splice Site | Available for shipment | Available now |
sa20583 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa40599
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > G
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000062349 | Essential Splice Site | 181 | 722 | 5 | 17 |
ENSDART00000125525 | Essential Splice Site | 191 | 260 | 6 | 8 |
ENSDART00000128050 | Essential Splice Site | 191 | 785 | 6 | 15 |
- Genomic Location (Zv9):
- Chromosome 5 (position 70488373)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 5 66813517 GRCz11 5 67491886 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GGAGCCATCGGGTCCTAAACGGGTGGAGCAGGTCGTGGCTGGATGGAAGG[T/G]TATTTAATTGTTTGTAATTAAAATGTTTTGTGTATGTGTTTGTTTATTTA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa20585
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- A > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000062349 | Nonsense | 183 | 722 | 6 | 17 |
ENSDART00000125525 | Nonsense | 193 | 260 | 7 | 8 |
ENSDART00000128050 | Nonsense | 193 | 785 | 7 | 15 |
- Genomic Location (Zv9):
- Chromosome 5 (position 70486088)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 5 66811232 GRCz11 5 67489601 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CACTTGATGTTGTTTTTATGATTAACTGTGTGTGTGTGTTCTGGCAGGTT[A/T]AAACTCCTCTTGAACAAGAGATTTTCCAACTCCTGCACAGCAACAGCCAG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa20584
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- A > T
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000062349 | Essential Splice Site | 222 | 722 | None | 17 |
ENSDART00000125525 | Essential Splice Site | 232 | 260 | None | 8 |
ENSDART00000128050 | Essential Splice Site | 232 | 785 | None | 15 |
- Genomic Location (Zv9):
- Chromosome 5 (position 70484546)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 5 66809690 GRCz11 5 67488059 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ATGCTCCATATTTTCTTCTGCTACAGCTTATAACACCGTTTTATTATTGC[A/T]GGCTAAGATTCGTCGTGCTGAGCTTCAAAAGGCAAGAGCGCTCCAGTCAT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa20583
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- T > G
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000062349 | Nonsense | 317 | 722 | 9 | 17 |
ENSDART00000125525 | None | 260 | None | 8 | |
ENSDART00000128050 | Nonsense | 327 | 785 | 10 | 15 |
- Genomic Location (Zv9):
- Chromosome 5 (position 70483127)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 5 66808271 GRCz11 5 67486640 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CATCAGAACAGCGGGAAGTGGGCCAAATCAAAGGCCATCATGGCCAAATA[T/G]GACGACTCAGTGAGAATTTGATACTTTTTTTCTTCTTCATGCTTTTAATC
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: