
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
h2afvl
- Ensembl ID:
- ENSDARG00000042502
- ZFIN ID:
- ZDB-GENE-050506-24
- Description:
- histone 2A family member ZA [Source:RefSeq peptide;Acc:NP_001036788]
- Human Orthologue:
- H2AFZ
- Human Description:
- H2A histone family, member Z [Source:HGNC Symbol;Acc:4741]
- Mouse Orthologue:
- H2afz
- Mouse Description:
- H2A histone family, member Z Gene [Source:MGI Symbol;Acc:MGI:1888388]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa21818 | Nonsense | Available for shipment | Available now |
sa18996 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa21818
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000062324 | Nonsense | 48 | 149 | 2 | 5 |
- Genomic Location (Zv9):
- Chromosome 10 (position 46371191)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 10 45139885 GRCz11 10 44986497 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GTGGAAAAGCCAAGACGAAAGCCGTCTCCAGATCTCAGAGAGCTGGTCTG[C/T]AGGTACTGACTCCAACAAAACATACATGCATAGTATAAATAGAAAGTGTC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa18996
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000062324 | Nonsense | 86 | 149 | 3 | 5 |
- Genomic Location (Zv9):
- Chromosome 10 (position 46368210)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 10 45142866 GRCz11 10 44989478 - KASP Assay ID:
- 2260-3718.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GAGCTACAGCTGCGGTTTACAGTGCTGCTATCCTGGAGTATCTCACCGCT[G/T]AGGTAACATCAGGGTTTATTTAATGAATTAATTTTTACCTAGAGTCTAAA
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: