si:dkey-250d21.1

Ensembl ID:
ENSDARG00000042492
ZFIN ID:
ZDB-GENE-030131-8276
Description:
Wu:fj64b09 protein [Source:UniProtKB/TrEMBL;Acc:Q7SYE3]
Human Orthologue:
PRKRIR
Human Description:
protein-kinase, interferon-inducible double stranded RNA dependent inhibitor, repressor of (P58 repr
Mouse Orthologue:
Prkrir
Mouse Description:
protein-kinase, interferon-inducible double stranded RNA dependent inhibitor, repressor of (P58 repr

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa34937 Nonsense Mutation detected in F1 DNA During 2018
sa44727 Nonsense Mutation detected in F1 DNA During 2018
sa14340 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa34937
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062311   None 718 None 5
ENSDART00000124166 Nonsense 784 2547 7 15
Genomic Location (Zv9):
Chromosome 10 (position 33027980)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 32129329
GRCz11 10 32073189
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACCACCCGAATGTGCAGAAACTAATAAAGAGGCATTGAAAGCTGCATTA[C/T]AGTCCGCTCTCACCGCAGCATATAGCAGGCAAAGCAGAGTCACTGATCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44727
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062311   None 718 None 5
ENSDART00000124166 Nonsense 1125 2547 7 15
Genomic Location (Zv9):
Chromosome 10 (position 33029003)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 32130352
GRCz11 10 32074212
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCAGAACTGGTTTGATGAGGCTTGTGGTTTTGCTCAGAGTCTTGGTGTA[C/T]AGGTTAAAGTGCCTGATAGTGTAGTTGTTCCAAGAGACAGCCTATTAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14340
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062311   None 718 None 5
ENSDART00000124166 Nonsense 1593 2547 11 15
Genomic Location (Zv9):
Chromosome 10 (position 33031122)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 32132471
GRCz11 10 32076331
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACAGGGAGTCAAAGTCTCAGGAAGGTGGCTCTGGGCTTCTTGGAAAACTA[T/A]CCACTAGCTGTGCACACTCCCAGTGAGTCTTGTGGACTTGCCTACTGGCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link