prkrir

Ensembl ID:
ENSDARG00000042489
ZFIN ID:
ZDB-GENE-040426-2045
Description:
protein-kinase, interferon-inducible double stranded RNA dependent inhibitor, repressor of (P58 repr
Human Orthologue:
PRKRIR
Human Description:
protein-kinase, interferon-inducible double stranded RNA dependent inhibitor, repressor of (P58 repr
Mouse Orthologue:
Prkrir
Mouse Description:
protein-kinase, interferon-inducible double stranded RNA dependent inhibitor, repressor of (P58 repr

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa18987 Nonsense Mutation detected in F1 DNA During 2018
sa41687 Nonsense Mutation detected in F1 DNA During 2018
sa45413 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa18987
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062309 Nonsense 246 748 5 5
Genomic Location (Zv9):
Chromosome 10 (position 33017424)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 32118773
GRCz11 10 32062633
KASP Assay ID:
2260-3405.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAAAAGTGCATTCGTGAAGAGCTGTTGGCTGAAGCTAAAGAAGGACGCTG[C/A]TTCTCTTTAGTTGTAGATAACCTGGTTGAGATAGAAGGAGAAAACTATGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41687
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062309 Nonsense 417 748 5 5
Genomic Location (Zv9):
Chromosome 10 (position 33017935)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 32119284
GRCz11 10 32063144
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGAGAAGGCTAATGTCCTTAAGGAGGCGTGCGGCTCTAAATGGACAGAG[C/T]AACACGATACCTTTGAATTGGCGGTTGACCTCTTGGAGTCTCTCCTGCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45413
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062309 Nonsense 671 748 5 5
Genomic Location (Zv9):
Chromosome 10 (position 33018699)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 32120048
GRCz11 10 32063908
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCGATGTGAAGTTCTTTCCCAACGTTTGTGCTCTACTGAAAGTTCTGTA[C/A]AATCTGCCACTCTTCGCTCTGACAAATGACAAATGCAGCACTGCAAAACA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link