si:dkey-23c22.2

Ensembl ID:
ENSDARG00000042456
ZFIN ID:
ZDB-GENE-081105-11
Description:
hypothetical protein LOC550258 [Source:RefSeq peptide;Acc:NP_001017595]
Human Orthologue:
MAD2L2
Human Description:
MAD2 mitotic arrest deficient-like 2 (yeast) [Source:HGNC Symbol;Acc:6764]
Mouse Orthologue:
Mad2l2
Mouse Description:
MAD2 mitotic arrest deficient-like 2 (yeast) Gene [Source:MGI Symbol;Acc:MGI:1919140]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa27187 Nonsense Mutation detected in F1 DNA During 2018
sa34382 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa27187
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062254 Nonsense 37 211 2 8

The following transcripts of ENSDARG00000042456 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 22953343)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 22324519
GRCz11 8 22345758
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGTTTTTGGAAGTGGCCATTCACCTCATTCTGTACGTCAGAGACATTTA[T/A]CCATCTGGGATCTTTCAGAAAAGGCAGAAATACAATGTACCTGTGCAGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34382
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062254 Nonsense 46 211 2 8

The following transcripts of ENSDARG00000042456 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 22953368)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 22324544
GRCz11 8 22345783
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCATTCTGTACGTCAGAGACATTTATCCATCTGGGATCTTTCAGAAAAGG[C/T]AGAAATACAATGTACCTGTGCAGGTAATGCTTTAAAATTGATTATTGATG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Visceral fat: Genome-wide association for abdominal subcutaneous and visceral adipose reveals a novel locus for visceral fat in women. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link