zgc:92715

Ensembl ID:
ENSDARG00000042448
ZFIN IDs:
ZDB-GENE-040718-330, ZDB-GENE-040718-330
Description:
HRAS-like suppressor [Source:RefSeq peptide;Acc:NP_001002590]
Human Orthologue:
HRASLS
Human Description:
HRAS-like suppressor [Source:HGNC Symbol;Acc:14922]
Mouse Orthologue:
Hrasls
Mouse Description:
HRAS-like suppressor Gene [Source:MGI Symbol;Acc:MGI:1351473]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa35171 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa35171
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062246 Essential Splice Site 1 169 3 5
ENSDART00000124344 Essential Splice Site 11 179 2 4
Genomic Location (Zv9):
Chromosome 11 (position 46228372)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 45045494
GRCz11 11 45423060
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAGGGTGGTAGAAATGTTCTGTGAAATGCTGAAGTGTTCGAGTGTGTCCA[G/A]ATGGCGTCAGGTGAAACTGATCACCTTCAGTGTGTGGAGGAGCCTCAGCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link