
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
si:ch211-251j10.3
- Ensembl ID:
- ENSDARG00000042409
- ZFIN ID:
- ZDB-GENE-081105-110
- Description:
- ral guanine nucleotide dissociation stimulator [Source:RefSeq peptide;Acc:NP_001116789]
- Human Orthologues:
- RALGDS, RGL4
- Human Descriptions:
- ral guanine nucleotide dissociation stimulator [Source:HGNC Symbol;Acc:9842]
- ral guanine nucleotide dissociation stimulator-like 4 [Source:HGNC Symbol;Acc:31911]
- Mouse Orthologue:
- Ralgds
- Mouse Description:
- ral guanine nucleotide dissociation stimulator Gene [Source:MGI Symbol;Acc:MGI:107485]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa38699 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa15004 | Essential Splice Site | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa38699
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- A > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000062181 | Nonsense | 112 | 812 | 2 | 17 |
ENSDART00000138959 | Nonsense | 137 | 813 | 2 | 16 |
- Genomic Location (Zv9):
- Chromosome 8 (position 31811977)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 8 30954703 GRCz11 8 30963935 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TTAAGGCTGGCACACTGGAGAAACTAGTGGAGTACATGGTCTCCGCCTTC[A/T]AAGGGAAAGACTACACTTACGTCACTATTTTCCTCTGCACCTACAGAGCA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa15004
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000062181 | Essential Splice Site | 754 | 812 | 16 | 17 |
ENSDART00000138959 | Essential Splice Site | 755 | 813 | 15 | 16 |
- Genomic Location (Zv9):
- Chromosome 8 (position 31799367)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 8 30942093 GRCz11 8 30951325 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TGACAAATCTGAAGACTATGAATTGTTACAGAGGGTCWCAAAGCATAAAG[G/A]TAAGGAACTGAAACAGGAAATATTGAAGGGCTTGGTTTTTYATTAGTTAT
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: