si:dkeyp-1h4.3

Ensembl ID:
ENSDARG00000042396
ZFIN ID:
ZDB-GENE-060503-557
Description:
hypothetical protein LOC100034496 [Source:RefSeq peptide;Acc:NP_001076539]
Human Orthologue:
TRIM35
Human Description:
tripartite motif-containing 35 [Source:HGNC Symbol;Acc:16285]
Mouse Orthologue:
Trim35
Mouse Description:
tripartite motif-containing 35 Gene [Source:MGI Symbol;Acc:MGI:1914104]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9656 Nonsense Available for shipment Available now
sa10637 Nonsense Available for shipment Available now
sa12433 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa9656
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062166 Nonsense 74 470 1 6
Genomic Location (Zv9):
Chromosome 18 (position 7094457)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 7672147
GRCz11 18 7631082
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTCCCCTAGCCCCAATCCCCCTATAAACATSATGCTGAGGAACATGTGT[G/T]AACTGATGAGGGAGGAGGTGCCYCAGGAGCCACCACAGGACAGTGTGGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10637
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062166 Nonsense 209 470 3 6
Genomic Location (Zv9):
Chromosome 18 (position 7089220)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 7666910
GRCz11 18 7625845
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGAATCGGCTCGGGTGATGGCTCTGAGGAGAGAGGAAGAGCAGAAGAAC[G/T]AGATCATTAAACAGAAGATGCAGGAGATCCAGTCARGGATGTTTTCTCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12433
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062166 Nonsense 317 470 6 6
Genomic Location (Zv9):
Chromosome 18 (position 7085877)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 7663567
GRCz11 18 7622502
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACCGGCCATCCTTACCTGCTGGTGTCGGATGATCTGACCACTATCACATA[C/A]TCTGACGAACACTTCCAGCAGCTTCCAGMAAAYCCCGAAAGATATGACGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link