odf3b

Ensembl ID:
ENSDARG00000042391
ZFIN ID:
ZDB-GENE-030131-7464
Description:
Outer dense fiber protein 3-B [Source:UniProtKB/Swiss-Prot;Acc:A3KQA5]
Human Orthologues:
ODF3, ODF3B
Human Descriptions:
outer dense fiber of sperm tails 3 [Source:HGNC Symbol;Acc:19905]
outer dense fiber of sperm tails 3B [Source:HGNC Symbol;Acc:34388]
Mouse Orthologues:
Odf3, Odf3b
Mouse Descriptions:
outer dense fiber of sperm tails 3 Gene [Source:MGI Symbol;Acc:MGI:1916537]
outer dense fiber of sperm tails 3B Gene [Source:MGI Symbol;Acc:MGI:1917363]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa45629 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa45629
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062156 Essential Splice Site 180 257 5 7
ENSDART00000127641 Essential Splice Site 180 257 4 6
Genomic Location (Zv9):
Chromosome 18 (position 7079501)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 7657191
GRCz11 18 7616126
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTTCAGCGGTCGTAGTGCAATCGGCAGCTTCCATGAAGATCTACGAAAG[G/A]TGCAGATCTGTCATTTTACAGCTTATACTTCGGGAAATGTATTTTGAAAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link