zgc:77650

Ensembl ID:
ENSDARG00000042382
ZFIN ID:
ZDB-GENE-030131-6151
Description:
ADP-ribosylation factor 4 [Source:RefSeq peptide;Acc:NP_956170]
Human Orthologue:
ARF5
Human Description:
ADP-ribosylation factor 5 [Source:HGNC Symbol;Acc:658]
Mouse Orthologue:
Arf5
Mouse Description:
ADP-ribosylation factor 5 Gene [Source:MGI Symbol;Acc:MGI:99434]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa6500 Nonsense Mutation detected in F1 DNA During 2018
sa13809 Essential Splice Site Available for shipment Available now
sa23227 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa6500
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062143 Nonsense 58 180 3 6
Genomic Location (Zv9):
Chromosome 18 (position 7023261)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 7600951
GRCz11 18 7559886
KASP Assay ID:
554-4533.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAAATACTATATTTTTATTGGGCAGGTTTTAATGTAGAGACTGTTGAATA[C/A]AAGAACATCTGCTTCACTGTGTGGGACGTYGGCGGTCAGGACAAGATTCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13809
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062143 Essential Splice Site 111 180 5 6
Genomic Location (Zv9):
Chromosome 18 (position 7023638)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 7601328
GRCz11 18 7560263
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTAATGTGGTTAAGTTGCCTCATCTRYGTCTTTTCCTGTGCAYATGTGCA[G/A]TTGCAGGAAGATGAACTGAGGGAYGCYGTGCTTCTGGTTTTTGCAAACAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23227
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062143 Nonsense 154 180 6 6
Genomic Location (Zv9):
Chromosome 18 (position 7025354)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 7603044
GRCz11 18 7561979
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAGCTGTACGTTTTGTCTGATGTTTTCTGTCTGGGCTTCTTGCAGTGGTA[T/A]GTTCAAGCAACCTGCGCAACACAGGGCACTGGACTCTATGAAGGACTGGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Type 2 diabetes: Genome-wide association study in a Chinese population identifies a susceptibility locus for type 2 diabetes at 7q32 near PAX4. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link