
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
cldnk
- Ensembl ID:
- ENSDARG00000042357
- ZFIN ID:
- ZDB-GENE-040801-201
- Description:
- claudin k [Source:RefSeq peptide;Acc:NP_001003464]
- Human Orthologues:
- CLDN17, CLDN8
- Human Descriptions:
- claudin 17 [Source:HGNC Symbol;Acc:2038]
- claudin 8 [Source:HGNC Symbol;Acc:2050]
- Mouse Orthologues:
- Cldn17, Cldn8
- Mouse Descriptions:
- claudin 17 Gene [Source:MGI Symbol;Acc:MGI:2652030]
- claudin 8 Gene [Source:MGI Symbol;Acc:MGI:1859286]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa33297 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa98 | Nonsense | Confirmed mutation in F2 line | During 2018 |
Mutation Details
- Allele Name:
- sa33297
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > G
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000062116 | Nonsense | 148 | 216 | 2 | 2 |
- Genomic Location (Zv9):
- Chromosome 3 (position 47641546)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 3 49088671 GRCz11 3 50123939 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ATCCTTGTGCCTGTTTGCTGGACGGCCCATTCCATCATCAGGGATTTCTA[T/G]GACCCCTATGTGGCGGCCCCACACAAACGTGAGCTTGGACCCGCTCTCTA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa98
- Current Status:
-
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000062116 | Nonsense | 166 | 216 | 2 | 2 |
- Genomic Location (Zv9):
- Chromosome 3 (position 47641599)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 3 49088618 GRCz11 3 50123886 - KASP Assay ID:
- 554-0135.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CCCCTATGTGGCGGCCCCACACAAACGTGAGCTTGGACCCGCTCTCTACT[T/A]GGGCTGGGGGGCTTCGGCTTTACTGTTGATTGGTGGATCGCTTCTCTATG
- Associated Phenotype:
Normal
Stage Entity Quality Tag Larval:Day 5
ZFS:0000037whole organism
ZFA:0001094quality
PATO:0000001normal
PATO:0000461
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Response to statin therapy: Genome-wide association of lipid-lowering response to statins in combined study populations. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: