syt1b

Ensembl ID:
ENSDARG00000042350
ZFIN ID:
ZDB-GENE-060503-166
Description:
synaptotagmin Ib [Source:RefSeq peptide;Acc:NP_001082930]
Human Orthologue:
SYT1
Human Description:
synaptotagmin I [Source:HGNC Symbol;Acc:11509]
Mouse Orthologue:
Syt1
Mouse Description:
synaptotagmin I Gene [Source:MGI Symbol;Acc:MGI:99667]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa43039 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa43039
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101242 Nonsense 182 388 4 8
ENSDART00000135024 Nonsense 182 355 4 7
Genomic Location (Zv9):
Chromosome 18 (position 6853526)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 7431216
GRCz10 21 44016217
GRCz11 18 7390151
GRCz11 21 44011383
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGGGCTGAAGGGCTTGCTGCTATGGACATGAGTGGCACTTCAGATCCATA[C/A]GTTAAAGTTTACCTCCTCCCCGACAAGAAAAAAAAGTTTGAGACTAAAGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link