si:dkey-91m11.5

Ensembl ID:
ENSDARG00000042329
ZFIN ID:
ZDB-GENE-060503-932
Description:
hypothetical protein LOC560226 [Source:RefSeq peptide;Acc:NP_001116725]
Human Orthologue:
BCR
Human Description:
breakpoint cluster region [Source:HGNC Symbol;Acc:1014]
Mouse Orthologue:
Bcr
Mouse Description:
breakpoint cluster region Gene [Source:MGI Symbol;Acc:MGI:88141]

Alleles

There are 8 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa34433 Nonsense Mutation detected in F1 DNA During 2018
sa41236 Nonsense Mutation detected in F1 DNA During 2018
sa41237 Nonsense Mutation detected in F1 DNA During 2018
sa31660 Essential Splice Site Available for shipment Available now
sa41238 Nonsense Mutation detected in F1 DNA During 2018
sa21327 Nonsense Available for shipment Available now
sa16588 Essential Splice Site Available for shipment Available now
sa34434 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa34433
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062073 Nonsense 44 1291 1 23
ENSDART00000137009 Nonsense 44 1290 1 23
Genomic Location (Zv9):
Chromosome 8 (position 31349341)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 30492067
GRCz11 8 30501299
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGTCGGAGACATCGAGCTAGAACTGGAGAAATGCCGAAACTCCATTAGG[C/T]GACTGGAGATGGAAGTAAACAAGGAGCGATTTCGAATGATCTACCTGCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41236
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062073 Nonsense 399 1291 1 23
ENSDART00000137009 Nonsense 399 1290 1 23
Genomic Location (Zv9):
Chromosome 8 (position 31350406)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 30493132
GRCz11 8 30502364
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAAGCCCCACCGCCTACCGAATGTACAGAGAGAAGAGCCGCTCTCCATCC[C/T]AGCACTCCCAGCAGTCGTTCGAGAGTGGCAGCCCTCCCACACCACAGTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41237
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062073 Nonsense 416 1291 1 23
ENSDART00000137009 Nonsense 416 1290 1 23
Genomic Location (Zv9):
Chromosome 8 (position 31350457)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 30493183
GRCz11 8 30502415
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCACTCCCAGCAGTCGTTCGAGAGTGGCAGCCCTCCCACACCACAGTCC[C/T]AAAAGCGTCTCAAGCAGCAGTTAGCACTCTCTGAAGCCAATAGCGGTGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31660
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062073 Essential Splice Site 771 1291 9 23
ENSDART00000137009 Essential Splice Site 770 1290 9 23
Genomic Location (Zv9):
Chromosome 8 (position 31418326)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 30561052
GRCz11 8 30570284
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTTTACCGACATTCTGCTCTGCGCTAAATTGAAGAAACAAACTGGAGGG[T/C]AAGACATGATTTATTTTTCATTCCTATAGAATCATTGTTGTTTGTCTTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41238
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062073 Nonsense 798 1291 10 23
ENSDART00000137009 Nonsense 797 1290 10 23
Genomic Location (Zv9):
Chromosome 8 (position 31418533)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 30561259
GRCz11 8 30570491
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATCCCGCTAGCGGACGTCACCTTCCAGACCATCGATGAGTCTGAGTCCT[C/A]GCCTGTTCCACAGATACCAGAAGAGGAGATTGATGCTTTGAAGGTCAAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21327
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062073 Nonsense 881 1291 12 23
ENSDART00000137009 Nonsense 880 1290 12 23
Genomic Location (Zv9):
Chromosome 8 (position 31419930)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 30562656
GRCz11 8 30571888
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTCAGGGTTATACATTCCTGATTTCATCTGACTATGAACGAGAAGAATG[G/A]AGAGAAGTCATTCGGGAGCAGCAGAAAAAATGTAAGCACTTACAAGATGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16588
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062073 Essential Splice Site 1024 1291 16 23
ENSDART00000137009 Essential Splice Site 1023 1290 16 23
Genomic Location (Zv9):
Chromosome 8 (position 31424264)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 30566990
GRCz11 8 30576222
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGATGATGGCGAAAACATKGATCGCGTCATGGCCAAGGGGCAGATTCAGG[T/C]ACGGCTTTTTCAGTTTGGACYKTATCAGAATTACTTTMACTCTACGTTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34434
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062073 Nonsense 1066 1291 18 23
ENSDART00000137009 Nonsense 1065 1290 18 23
Genomic Location (Zv9):
Chromosome 8 (position 31434948)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 30577674
GRCz11 8 30586906
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTCTATGCGATTTACCAGCAGAGAGTTCAGTCTGAAGCGGATGCCCTCC[A/T]GAAAACAGTCTGGAGTGTTTGGAGTCAAAATCGGGGCCGTCACTAAGTAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link