si:dkey-38o13.1

Ensembl ID:
ENSDARG00000042308
ZFIN ID:
ZDB-GENE-070705-462
Description:
Novel protein similar to rho/rac guanine nucleotide exchange factor (GEF) 18 (Arhgef18) [Source:UniP
Human Orthologue:
ARHGEF18
Human Description:
Rho/Rac guanine nucleotide exchange factor (GEF) 18 [Source:HGNC Symbol;Acc:17090]
Mouse Orthologue:
Arhgef18
Mouse Description:
rho/rac guanine nucleotide exchange factor (GEF) 18 Gene [Source:MGI Symbol;Acc:MGI:2142567]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa37443 Essential Splice Site Mutation detected in F1 DNA During 2018
sa24090 Nonsense Available for shipment Available now
sa24089 Nonsense Available for shipment Available now
sa10836 Essential Splice Site Available for shipment Available now
sa37442 Essential Splice Site, Splice Site Mutation detected in F1 DNA During 2018
sa13725 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa37443
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010991 Essential Splice Site 414 1150 10 23
ENSDART00000141572   None 280 None 4
ENSDART00000145229 Essential Splice Site 338 692 8 16
Genomic Location (Zv9):
Chromosome 22 (position 10961958)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 10822126
GRCz11 22 10851808
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATAACCAAGTATCCTGTGCTTCTGGAGCGCATCCTGCACAACACTGAAGG[T/C]TGGTTTTTTGAAATGTAATTGAAACTATCCAGTTATGGTAGATTTGTAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24090
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010991 Nonsense 534 1150 13 23
ENSDART00000141572   None 280 None 4
ENSDART00000145229 Nonsense 458 692 11 16
Genomic Location (Zv9):
Chromosome 22 (position 10957347)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 10817515
GRCz11 22 10847197
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCTGTGTTCGTTTTTTCCACAGGACAACAAGCCGTCGGTCATTTCTTTG[C/T]AGAAGTTGATTGTGCGTGAGGTGGCGCACGAAGAGCGGGCAATGTTCCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24089
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010991 Nonsense 540 1150 13 23
ENSDART00000141572   None 280 None 4
ENSDART00000145229 Nonsense 464 692 11 16
Genomic Location (Zv9):
Chromosome 22 (position 10957329)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 10817497
GRCz11 22 10847179
KASP Assay ID:
2261-6482.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACAGGACAACAAGCCGTCGGTCATTTCTTTGCAGAAGTTGATTGTGCGT[G/T]AGGTGGCGCACGAAGAGCGGGCAATGTTCCTCATCTGCGCTTCCTCAAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10836
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010991 Essential Splice Site 720 1150 16 23
ENSDART00000141572   None 280 None 4
ENSDART00000145229 Essential Splice Site 644 692 14 16
Genomic Location (Zv9):
Chromosome 22 (position 10954689)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 10814857
GRCz11 22 10844539
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCCGACACATTCGGCGGATACGATAGCAATTCTAGYGCACTGCCTAAGAG[T/A]AAGAGTCAYACCAATAAACATGTTTTACGTTAGGAATGCATCGATTTAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37442
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > G
Consequence:
Essential Splice Site, Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010991 Essential Splice Site 760 1150 18 23
ENSDART00000141572   None 280 None 4
ENSDART00000145229 Splice Site None 692 None 16
Genomic Location (Zv9):
Chromosome 22 (position 10950396)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 10810564
GRCz11 22 10840246
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTATACACAATAATATGTTTTTCTTTTATTTTATGGTGTCTGTCTCTTC[A/G]GGACGAGGCTTCCTCACCTGCCAGCACCAACATGTGGTCCTCGTGTAAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13725
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010991 Essential Splice Site 780 1150 18 23
ENSDART00000141572   None 280 None 4
ENSDART00000145229   None 692 None 16
Genomic Location (Zv9):
Chromosome 22 (position 10950330)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 10810498
GRCz11 22 10840180
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACCTGCCAGCAYCAACATGTGGTCCTCRTGTAAACTTCCTGAATCAGAGG[T/G]GAGAGCGAGCGTTCATCATCATGCAGAAATTAAGACGATTATGCCTCTCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link