zgc:66286

Ensembl ID:
ENSDARG00000042245
ZFIN ID:
ZDB-GENE-040426-1593
Description:
hypothetical protein LOC393488 [Source:RefSeq peptide;Acc:NP_956810]
Human Orthologue:
MYL4
Human Description:
myosin, light chain 4, alkali; atrial, embryonic [Source:HGNC Symbol;Acc:7585]
Mouse Orthologue:
Myl4
Mouse Description:
myosin, light polypeptide 4 Gene [Source:MGI Symbol;Acc:MGI:97267]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa32825 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa32825
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061955 Nonsense 112 153 3 5
Genomic Location (Zv9):
Chromosome 2 (position 2657929)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 2638296
GRCz11 2 2480195
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGAGAGTGTTTGACAAAGAGGGCAACGGGACAGTGATGGGTGCTGAGCTC[A/T]GACACGTCCTCGCTACTTTAGGTAAACTCCAACATTCATTACATTCAGAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link