specc1lb

Ensembl ID:
ENSDARG00000042232
ZFIN ID:
ZDB-GENE-090423-1
Human Orthologue:
SPECC1L
Human Description:
sperm antigen with calponin homology and coiled-coil domains 1-like [Source:HGNC Symbol;Acc:29022]
Mouse Orthologue:
Specc1l
Mouse Description:
sperm antigen with calponin homology and coiled-coil domains 1-like Gene [Source:MGI Symbol;Acc:MGI:

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa43597 Essential Splice Site Mutation detected in F1 DNA During 2018
sa11703 Nonsense Available for shipment Available now
sa6665 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa43597
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061912 Essential Splice Site 97 1121 2 15
ENSDART00000142569 Essential Splice Site 97 1121 3 16
ENSDART00000146062   None 106 None 3
Genomic Location (Zv9):
Chromosome 21 (position 11446890)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 13148255
GRCz11 21 13245243
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCTCTCAGATCACCAGCAACACTGAGACAAGGTCCAAGACCACTTCAGG[T/C]AGTGTTAGGTATTGCCTTGGTTCTAGCATATTCAGCAGGAGGTTTTTTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11703
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061912 Nonsense 572 1121 3 15
ENSDART00000142569 Nonsense 572 1121 4 16
ENSDART00000146062   None 106 None 3
Genomic Location (Zv9):
Chromosome 21 (position 11448419)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 13149784
GRCz11 21 13246772
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCAAAGCAGAGTTAGARGCATTAAGGGTGCTGTCTGAAGGGGAGCAGGTG[G/T]AGCTGAACCGCTGTAGAATCCAACTTGAGCAAGAGAGGCAGAGAGTGGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6665
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061912 Essential Splice Site 1092 1121 14 15
ENSDART00000142569 Essential Splice Site 1092 1121 15 16
ENSDART00000146062   None 106 None 3
Genomic Location (Zv9):
Chromosome 21 (position 11485464)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 13186829
GRCz11 21 13283817
KASP Assay ID:
554-4492.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CACTTTAGCCTTCCAGGCAGCAGAAAGCGTTGGAATTAAATCAACACTGG[T/A]GAGTTGAGTTTAATATGATCATCACCACTATTTTACATATCCATTTGCTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link