zgc:112101

Ensembl ID:
ENSDARG00000042214
ZFIN ID:
ZDB-GENE-050417-264
Description:
hypothetical protein LOC550443 [Source:RefSeq peptide;Acc:NP_001017748]
Human Orthologue:
C7orf23
Human Description:
chromosome 7 open reading frame 23 [Source:HGNC Symbol;Acc:21707]
Mouse Orthologue:
4930420K17Rik
Mouse Description:
RIKEN cDNA 4930420K17 gene Gene [Source:MGI Symbol;Acc:MGI:3606159]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa7301 Essential Splice Site, Missense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa7301
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > G
Consequence:
Essential Splice Site, Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061904 Essential Splice Site 39 148 None 5
ENSDART00000134827 Missense 45 119 2 4
ENSDART00000142866 Missense 5 114 1 4
ENSDART00000147467 Missense 45 154 2 5
Genomic Location (Zv9):
Chromosome 18 (position 8377564)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 8954942
GRCz11 18 8912961
KASP Assay ID:
554-4577.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTGAAATATAAAACCAACTTTACCTTAATCCAGAAACATGGATGATTTC[A/G]GGACGCGCTCCAGTGGGACACACAACACGCTGCTCGGAGAGACTTTCACA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link