smek1

Ensembl ID:
ENSDARG00000042187
ZFIN ID:
ZDB-GENE-030131-3958
Description:
Serine/threonine-protein phosphatase 4 regulatory subunit 3 [Source:UniProtKB/Swiss-Prot;Acc:Q5SP90]
Human Orthologue:
SMEK1
Human Description:
SMEK homolog 1, suppressor of mek1 (Dictyostelium) [Source:HGNC Symbol;Acc:20219]
Mouse Orthologue:
Smek1
Mouse Description:
SMEK homolog 1, suppressor of mek1 (Dictyostelium) Gene [Source:MGI Symbol;Acc:MGI:1915984]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa6639 Essential Splice Site Mutation detected in F1 DNA During 2018
hu7878 Essential Splice Site Available for shipment Available now
sa32303 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa6639
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061843 Essential Splice Site 48 818 1 15

The following transcripts of ENSDARG00000042187 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 20 (position 33525634)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 33583874
GRCz11 20 33486753
KASP Assay ID:
554-5363.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGGAGAGGCTCAAAGGCATGTCTCTCCTGGTGCGCGCCGAAAGCGATGG[T/A]AGGTTTCAAAACACTGGAAGATGATGAACAGGTTTGCTTTTCATTGACTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
hu7878
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061843 Essential Splice Site 488 818 9 15

The following transcripts of ENSDARG00000042187 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 20 (position 33514626)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 33572866
GRCz11 20 33475745
KASP Assay ID:
554-2384.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCTCCGCTCCACTTCTTGCCAACACCACTGAAGAAAAACCCAGCAAAGG[T/C]AATAACTTTTACTATCTTTTTGAGCATGTGTGTGTATGTGTACGCTTGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32303
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061843 Nonsense 678 818 13 15

The following transcripts of ENSDARG00000042187 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 20 (position 33510031)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 33568271
GRCz11 20 33471150
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACTGGAAGACGAGGAGGAGATGTGGTTTAATACGGATGAGGAAGACTTA[G/T]AGGATGGTGAAGCAGTTGTGCCTCCGTCGGACAAGATGAAGAATGACGAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link