si:dkey-250l23.2

Ensembl ID:
ENSDARG00000042172
ZFIN ID:
ZDB-GENE-081104-392
Description:
Novel protein similar to vertebrate complement component 7 (C7) [Source:UniProtKB/TrEMBL;Acc:B0S6X4]
Human Orthologue:
C7
Human Description:
complement component 7 [Source:HGNC Symbol;Acc:1346]
Mouse Orthologue:
C7
Mouse Description:
complement component 7 Gene [Source:MGI Symbol;Acc:MGI:88235]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17248 Essential Splice Site Available for shipment Available now
sa18181 Essential Splice Site Available for shipment Available now
sa12725 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa17248
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061803 Essential Splice Site 113 858 5 18
ENSDART00000146933 Essential Splice Site 123 868 5 18
Genomic Location (Zv9):
Chromosome 8 (position 32728437)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 31871163
GRCz11 8 31880395
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACCTTTAAAATACGCATTGGATAGTTTANTTTTTTTCTCCTTTTCTTWTA[A/G]GGGAAATGYATCAGCCTSTCTCTGGTGTGCAATAGTGATCAGGATTGTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18181
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061803 Essential Splice Site 568 858 13 18
ENSDART00000146933 Essential Splice Site 578 868 13 18
Genomic Location (Zv9):
Chromosome 8 (position 32739730)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 31882456
GRCz11 8 31891688
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CACTGCCACTGTGTGGAAACTCACTGWCTTACTGATTCTGGCCTGTTTTC[A/T]GYTCAATGGAGCCTCACTGCTTTGATGAYTCGATTAARCCCAGGGAAAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12725
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061803 Essential Splice Site 705 858 16 18
ENSDART00000146933 Essential Splice Site 715 868 16 18
Genomic Location (Zv9):
Chromosome 8 (position 32741766)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 31884492
GRCz11 8 31893724
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGAAAATCATTGATGCATAAYAATAATGTAAAGGAAATTACATTGTTCAC[A/T]GCAGTTTTAAAGCCGACGGTTGYGCCAKTGAAATGCCAGCCATGGRAGAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link