skia

Ensembl ID:
ENSDARG00000042151
ZFIN ID:
ZDB-GENE-990715-9
Description:
ski oncogene [Source:RefSeq peptide;Acc:NP_571010]
Human Orthologue:
SKI
Human Description:
v-ski sarcoma viral oncogene homolog (avian) [Source:HGNC Symbol;Acc:10896]
Mouse Orthologue:
Ski
Mouse Description:
ski sarcoma viral oncogene homolog (avian) Gene [Source:MGI Symbol;Acc:MGI:98310]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa12533 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa12533
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100667 Nonsense 404 727 4 7
Genomic Location (Zv9):
Chromosome 8 (position 17926681)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 17371569
GRCz11 8 17407281
KASP Assay ID:
2260-0368.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACAAGAGTCTGGAAAGTGCCGTGGCCCCAAACGTGGCTCTAACACCGCCG[C/T]AGAAAGGAGGACAGGCCTCTCCRTCGGCCCCMAGCAGCTCACATCCACAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link