zp3a.1

Ensembl ID:
ENSDARG00000042129
ZFIN ID:
ZDB-GENE-040727-1
Description:
zona pellucida glycoprotein 3a [Source:RefSeq peptide;Acc:NP_001013289]
Human Orthologues:
POMZP3, ZP3
Human Descriptions:
POM121 and ZP3 fusion [Source:HGNC Symbol;Acc:9203]
zona pellucida glycoprotein 3 (sperm receptor) [Source:HGNC Symbol;Acc:13189]
Mouse Orthologue:
Zp3
Mouse Description:
zona pellucida glycoprotein 3 Gene [Source:MGI Symbol;Acc:MGI:99215]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa37087 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa37087
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061744 Essential Splice Site 223 442 None 8
ENSDART00000128871 Essential Splice Site None 148 None 10
Genomic Location (Zv9):
Chromosome 20 (position 34017249)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 34089762
GRCz11 20 33992641
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAATTATGTAGTTTGGATTTGATTGCCTGATTTTTGGGCTGTTTGATTAC[A/T]GGAAACACAATGTGAGCAGTTCTGCCCTGCTGCCAGCTTGGACACCATAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link