
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
zp3a.1
- Ensembl ID:
- ENSDARG00000042129
- ZFIN ID:
- ZDB-GENE-040727-1
- Description:
- zona pellucida glycoprotein 3a [Source:RefSeq peptide;Acc:NP_001013289]
- Human Orthologues:
- POMZP3, ZP3
- Human Descriptions:
- POM121 and ZP3 fusion [Source:HGNC Symbol;Acc:9203]
- zona pellucida glycoprotein 3 (sperm receptor) [Source:HGNC Symbol;Acc:13189]
- Mouse Orthologue:
- Zp3
- Mouse Description:
- zona pellucida glycoprotein 3 Gene [Source:MGI Symbol;Acc:MGI:99215]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa37087 | Essential Splice Site | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa37087
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- A > T
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000061744 | Essential Splice Site | 223 | 442 | None | 8 |
ENSDART00000128871 | Essential Splice Site | None | 148 | None | 10 |
- Genomic Location (Zv9):
- Chromosome 20 (position 34017249)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 20 34089762 GRCz11 20 33992641 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CAATTATGTAGTTTGGATTTGATTGCCTGATTTTTGGGCTGTTTGATTAC[A/T]GGAAACACAATGTGAGCAGTTCTGCCCTGCTGCCAGCTTGGACACCATAT
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: