
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
si:dkey-4e7.3
- Ensembl ID:
- ENSDARG00000042124
- ZFIN ID:
- ZDB-GENE-070912-542
- Description:
- Novel protein [Source:UniProtKB/TrEMBL;Acc:B0S738]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa2504 | Essential Splice Site | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa2504
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- A > T
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000061736 | Essential Splice Site | None | 317 | 2 | 6 |
ENSDART00000132442 | Essential Splice Site | 69 | 259 | 3 | 6 |
- Genomic Location (Zv9):
- Chromosome 9 (position 7116200)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 9 7096293 GRCz11 9 7074684 - KASP Assay ID:
- 554-3031.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TTACCAGTCCAGATATTTAACCAGCAGCTGTTTTGAACACTTGTTTGCCC[A/T]GAAYTCAGCATGAAGAAGCTGTTTGTGGACGTGGACTGTGGTGTGGATGA
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: