si:dkey-4e7.3

Ensembl ID:
ENSDARG00000042124
ZFIN ID:
ZDB-GENE-070912-542
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:B0S738]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa2504 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa2504
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061736 Essential Splice Site None 317 2 6
ENSDART00000132442 Essential Splice Site 69 259 3 6
Genomic Location (Zv9):
Chromosome 9 (position 7116200)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 7096293
GRCz11 9 7074684
KASP Assay ID:
554-3031.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTACCAGTCCAGATATTTAACCAGCAGCTGTTTTGAACACTTGTTTGCCC[A/T]GAAYTCAGCATGAAGAAGCTGTTTGTGGACGTGGACTGTGGTGTGGATGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link