zgc:123115

Ensembl ID:
ENSDARG00000042122
ZFIN ID:
ZDB-GENE-051127-37
Description:
thioesterase, adipose associated [Source:RefSeq peptide;Acc:NP_001032661]
Human Orthologue:
ACOT11
Human Description:
acyl-CoA thioesterase 11 [Source:HGNC Symbol;Acc:18156]
Mouse Orthologue:
Acot11
Mouse Description:
acyl-CoA thioesterase 11 Gene [Source:MGI Symbol;Acc:MGI:1913736]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa41171 Nonsense Mutation detected in F1 DNA During 2018
sa11419 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa41171
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080026 Nonsense 123 340 6 11
ENSDART00000121660 Nonsense 123 585 4 15
ENSDART00000122730 Nonsense 123 253 5 7
ENSDART00000125014 Nonsense 123 575 6 17
ENSDART00000133666 Nonsense 123 138 5 5

The following transcripts of ENSDARG00000042122 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 18523037)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 17967925
GRCz11 8 18003637
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTCTCAGGTTGGGATTTCAGTGAGTTGTGAGGATCTCTTCAGTGACAGA[C/T]AGTGGAAAGTCTGCCATGCTTTTGCCACCTTCGTTGCTCGTCGTACAGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11419
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080026   None 340 None 11
ENSDART00000121660 Essential Splice Site 440 585 12 15
ENSDART00000122730   None 253 None 7
ENSDART00000125014 Essential Splice Site 440 575 14 17
ENSDART00000133666   None 138 None 5

The following transcripts of ENSDARG00000042122 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 18515146)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 17960034
GRCz11 8 17995746
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCCTACTGTCTGATYTAAGGCGAAGGAAGGYGTGGGACCACCACTACCA[G/A]TATGTAAAATGTATTTTTTCTGMAAGCTGKAGAATAATWATAATTTCAAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link