si:dkey-44k1.3

Ensembl ID:
ENSDARG00000042116
ZFIN ID:
ZDB-GENE-030131-6081
Description:
Si:dkey-44k1.3 protein [Source:UniProtKB/TrEMBL;Acc:Q502G4]
Human Orthologue:
TRIM35
Human Description:
tripartite motif-containing 35 [Source:HGNC Symbol;Acc:16285]
Mouse Orthologue:
Trim35
Mouse Description:
tripartite motif-containing 35 Gene [Source:MGI Symbol;Acc:MGI:1914104]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11565 Nonsense Available for shipment Available now
sa44267 Nonsense Mutation detected in F1 DNA During 2018
sa24642 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa11565
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061726 Nonsense 86 468 1 6

The following transcripts of ENSDARG00000042116 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 25 (position 17862867)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 17406731
GRCz11 25 17503131
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACCTGTGCCAGTCGTTTGTGAACCACAGAAGGTTTCTGGAGGAGCACTGT[G/T]AGGTTCACCAGCTGAGGAAGACTCTGGTKTGCTGTGAAGACGAGCAGCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44267
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061726 Nonsense 142 468 2 6

The following transcripts of ENSDARG00000042116 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 25 (position 17860265)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 17404129
GRCz11 25 17500529
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTTCAAATTGTAGGAAGCTCTTCGATCACAGCTTGATTTATTCACAAAT[C/T]AAAGGAAACATTTGCAGGATGCCAAAGCTGAGTTAAATTACAATTCTGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24642
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061726 Nonsense 370 468 6 6

The following transcripts of ENSDARG00000042116 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 25 (position 17855706)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 17399570
GRCz11 25 17495970
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCAAGGACAACACATCTTGGATGGTGGGTATCGCCATAGAGTCTGTCCAA[A/T]GAAAAGCTACCAGCGGCATCCCGGCTGGAGTCTGGTGTATCGGACGAGAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link