si:rp71-68g1.4

Ensembl ID:
ENSDARG00000042114
ZFIN ID:
ZDB-GENE-070912-715
Human Orthologue:
BIN1
Human Description:
bridging integrator 1 [Source:HGNC Symbol;Acc:1052]
Mouse Orthologue:
Bin1
Mouse Description:
bridging integrator 1 Gene [Source:MGI Symbol;Acc:MGI:108092]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa217 Nonsense Available for shipment Available now
sa25417 Nonsense Mutation detected in F1 DNA During 2018
sa13925 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa217
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081606 Nonsense 20 567 1 19
ENSDART00000144600   None 192 None 5
ENSDART00000146424 Nonsense 20 386 1 14
Genomic Location (Zv9):
Chromosome 9 (position 7486049)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 7466142
GRCz11 9 7444533
KASP Assay ID:
554-0156.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AATTACCGATGGGGAAAGGGGTGTCCGCTGGAAAAATAGCAAGCAATGTA[C/T]AGAAGAAAATTACTAGAGCACAGGAGAAGGTAAGATATTTTAATAATCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25417
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081606 Nonsense 55 567 2 19
ENSDART00000144600   None 192 None 5
ENSDART00000146424 Nonsense 55 386 2 14
Genomic Location (Zv9):
Chromosome 9 (position 7483592)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 7463685
GRCz11 9 7442076
KASP Assay ID:
554-7547.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGAGACTAAAGATCTGGCGTTTGAGGAGGGCGTGATCAACTTTAATAAA[C/T]AGTTGGTGAGTGGCTTTCTGACTGTACACGATATTTCTTCAAACGTCCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13925
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081606 Essential Splice Site 74 567 3 19
ENSDART00000144600   None 192 None 5
ENSDART00000146424 Essential Splice Site 74 386 3 14
Genomic Location (Zv9):
Chromosome 9 (position 7483427)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 7463520
GRCz11 9 7441911
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGTACCAAACWGCAGAAAGACCTTCGGGCCTATTTGACTGCTGTGAAAG[G/C]TACGATTATGAWGAAATTACACWCCTGCGACATGAAATGAAATGTGTTGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link