si:dkeyp-11g8.5

Ensembl ID:
ENSDARG00000042057
ZFIN ID:
ZDB-GENE-041014-189
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:Q5RG85]
Human Orthologue:
C1orf25
Human Description:
chromosome 1 open reading frame 25 [Source:HGNC Symbol;Acc:16782]
Mouse Orthologue:
1190005F20Rik
Mouse Description:
RIKEN cDNA 1190005F20 gene Gene [Source:MGI Symbol;Acc:MGI:1916185]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15727 Nonsense Available for shipment Available now
sa37096 Nonsense Mutation detected in F1 DNA During 2018
sa3081 Nonsense F2 line generated During 2018
sa23758 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa15727
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061637 Nonsense 94 691 4 16
ENSDART00000139648 Nonsense 92 213 4 7
ENSDART00000146924 Nonsense 92 691 4 15
Genomic Location (Zv9):
Chromosome 20 (position 34414941)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 34487454
GRCz11 20 34390333
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TSAACCTATTYACTCATTTTGACAGCTGGGAGAAAATCTTGTCCATTGTG[T/A]CCAGAAGARAAGTTTAAGGCCTGTTACAGTCATAAGCTTAGACGGCACCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37096
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061637 Nonsense 465 691 11 16
ENSDART00000139648   None 213 None 7
ENSDART00000146924 Nonsense 463 691 11 15
Genomic Location (Zv9):
Chromosome 20 (position 34420236)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 34492749
GRCz11 20 34395628
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCACCCAGGCAGATGAGTCTGCTAAAAAACTGCGGCAGCTGTTGCACTGC[C/T]AATGGTGTGAAGAAAGGGTGTTCCTCAAGCCAGGAAGTATGGTGGAAGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3081
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061637 Nonsense 466 691 11 16
ENSDART00000139648   None 213 None 7
ENSDART00000146924 Nonsense 464 691 11 15
Genomic Location (Zv9):
Chromosome 20 (position 34420241)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 34492754
GRCz11 20 34395633
KASP Assay ID:
554-3197.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGGCAGATGAGTCTGCTAAAAAACTGCGGCAGCTGTTGCACTGCCAATG[G/A]TGTGAAGAAAGGGTGTTCCTCAAGCCAGGAAGTATGGTGGAAGGTRAGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23758
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061637 Essential Splice Site 628 691 15 16
ENSDART00000139648   None 213 None 7
ENSDART00000146924 Essential Splice Site 628 691 14 15
Genomic Location (Zv9):
Chromosome 20 (position 34423344)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 34495857
GRCz11 20 34398736
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCTACTACAGCATCCATCGGCACAGCATTCGCGGCATGAACATGCCCAA[G/A]TACGTCAGTGCAAAACCTTTACATAAACAGTCATGCATTGCCATCCTGTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link