si:dkeyp-11g8.6

Ensembl ID:
ENSDARG00000042055
ZFIN ID:
ZDB-GENE-041014-181
Description:
hypothetical protein LOC559657 [Source:RefSeq peptide;Acc:NP_001138263]
Human Orthologue:
FAM129A
Human Description:
family with sequence similarity 129, member A [Source:HGNC Symbol;Acc:16784]
Mouse Orthologue:
Fam129a
Mouse Description:
family with sequence similarity 129, member A Gene [Source:MGI Symbol;Acc:MGI:2137237]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15308 Essential Splice Site Available for shipment Available now
sa11035 Nonsense Available for shipment Available now
sa43490 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa15308
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061632 Essential Splice Site 104 835 3 14
Genomic Location (Zv9):
Chromosome 20 (position 34430716)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 34503229
GRCz11 20 34406108
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTATCGTGAKCCGTGCCTGTTACGTTTTGGAGGTCCACGAGAGCTATAAG[G/A]TAAGAGCCACAATCCATCWTTTTCTGACWGAAGATAGATARAATGTTTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11035
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061632 Nonsense 462 835 11 14
Genomic Location (Zv9):
Chromosome 20 (position 34438285)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 34510798
GRCz11 20 34413677
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAAAAAAGGCTCTGCTGGACCCGTCAGTCAATTTTTCAGAGGCAATGCAA[A/T]AAGCTTCCGACCGGGTTCTGAAAGTAAGCATATCACTTTACATTTACAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43490
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061632 Nonsense 624 835 14 14
Genomic Location (Zv9):
Chromosome 20 (position 34441799)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 34514312
GRCz11 20 34417191
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATCTGTCACTGTTCACTCGCCAAACTCAGAAAACAGCACTCCCATGGGA[C/T]GAATCGACGAGGGAGAGTACAAAACACCCATAGAGGGATGCAGCGATGAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link