zgc:171971

Ensembl ID:
ENSDARG00000042054
ZFIN ID:
ZDB-GENE-070928-37
Description:
hypothetical protein LOC569690 [Source:RefSeq peptide;Acc:NP_001103298]
Human Orthologue:
POLR3D
Human Description:
polymerase (RNA) III (DNA directed) polypeptide D, 44kDa [Source:HGNC Symbol;Acc:1080]
Mouse Orthologue:
Polr3d
Mouse Description:
polymerase (RNA) III (DNA directed) polypeptide D Gene [Source:MGI Symbol;Acc:MGI:1914315]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa41963 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa41963
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061633 Nonsense 93 390 4 9
Genomic Location (Zv9):
Chromosome 12 (position 7948193)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 7242167
GRCz11 12 7275670
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGAGGAGCCTCACAGTGCACCAAAAAAAGAGAGAAGAGACAGGGAAGAC[A/T]GACACAGAGAGAGACGACAGCGACGAGAAAAGCCTCAGACCATTCAGTCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link