
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
hmg20b
- Ensembl ID:
- ENSDARG00000042045
- ZFIN ID:
- ZDB-GENE-030131-4258
- Description:
- SWI/SNF-related matrix-associated actin-dependent regulator of chromatin subfamily E member 1-relate
- Human Orthologue:
- HMG20B
- Human Description:
- high-mobility group 20B [Source:HGNC Symbol;Acc:5002]
- Mouse Orthologue:
- Hmg20b
- Mouse Description:
- high mobility group 20 B Gene [Source:MGI Symbol;Acc:MGI:1341190]
Alleles
There are 4 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa17207 | Essential Splice Site | Available for shipment | Available now |
sa29763 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa37496 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa24153 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa17207
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- A > C
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000061617 | Essential Splice Site | None | 301 | 2 | 9 |
- Genomic Location (Zv9):
- Chromosome 22 (position 20490345)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 22 20147038 GRCz11 22 20172016 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TTGTTAGTCTTTTATATTTCATCTAAAYATATTTTCTTTTTTGYCTTCCC[A/C]GAATTCCGTGAATCCACGTTATGGGTGGTGTAAAGCAAGAGCAGACTGAT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa29763
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000061617 | Nonsense | 18 | 301 | 2 | 9 |
- Genomic Location (Zv9):
- Chromosome 22 (position 20490417)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 22 20147110 GRCz11 22 20172088 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TGGGTGGTGTAAAGCAAGAGCAGACTGATGCTCCTGCATCTAAAGACTCT[C/T]AGCAGACTGATTCGCCACAGGAAGAGGTTAGATACAGACTGCTTTAACAT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa37496
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000061617 | Nonsense | 102 | 301 | 4 | 9 |
- Genomic Location (Zv9):
- Chromosome 22 (position 20490929)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 22 20147622 GRCz11 22 20172600 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GGAAAACCTCACTCTGATTAAATGCAACCACTTTTTTTAAAACAGCGTTA[C/A]CTTGATGAAGCCGAAAGGGACAAAATGCAGTATGCACGAGAACTCAGGGA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa24153
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000061617 | Nonsense | 233 | 301 | 7 | 9 |
- Genomic Location (Zv9):
- Chromosome 22 (position 20493727)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 22 20150420 GRCz11 22 20175398 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AGCGCCTGGAAGCTGAGCTAGGCCAAGATGAGCTTCGTACGCAGGCCCTA[C/T]AGCGCCACCTACAGGCTATCAAACAGACGCTAGTCAGCAGCTTGGCTACT
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: