cyp11b2

Ensembl ID:
ENSDARG00000042014
ZFIN ID:
ZDB-GENE-070828-1
Description:
cytochrome P450, family 11, subfamily B, polypeptide 2 [Source:RefSeq peptide;Acc:NP_001073673]
Human Orthologues:
CYP11B1, CYP11B2
Human Descriptions:
cytochrome P450, family 11, subfamily B, polypeptide 1 [Source:HGNC Symbol;Acc:2591]
cytochrome P450, family 11, subfamily B, polypeptide 2 [Source:HGNC Symbol;Acc:2592]
Mouse Orthologues:
Cyp11b1, Cyp11b2
Mouse Descriptions:
cytochrome P450, family 11, subfamily b, polypeptide 1 Gene [Source:MGI Symbol;Acc:MGI:88583]
cytochrome P450, family 11, subfamily b, polypeptide 2 Gene [Source:MGI Symbol;Acc:MGI:88584]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa44863 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa44863
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061572 Essential Splice Site 315 628 None 13
ENSDART00000131093 Essential Splice Site 310 623 None 13
Genomic Location (Zv9):
Chromosome 16 (position 57908979)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 54643617
GRCz11 16 54463019
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACACTGACCCTTGACCCCAGTCCTGACCTCTTCCGCTTCGCATTGGAAGG[T/G]CAGCCTCTTCTAATTCCTCGTTAATAGAGAAGGGCTGTTACTGAAACTGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link