si:dkey-78l4.13

Ensembl ID:
ENSDARG00000042003
ZFIN ID:
ZDB-GENE-060503-459
Description:
Novel protein containing a trypsin domain [Source:UniProtKB/TrEMBL;Acc:Q1LUK2]
Human Orthologue:
GZMM
Human Description:
granzyme M (lymphocyte met-ase 1) [Source:HGNC Symbol;Acc:4712]
Mouse Orthologue:
Gzmm
Mouse Description:
granzyme M (lymphocyte met-ase 1) Gene [Source:MGI Symbol;Acc:MGI:99549]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa37494 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa37494
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078374 Nonsense 31 249 2 5
ENSDART00000124070 Nonsense 29 251 2 6
ENSDART00000145079   None 164 None 3
Genomic Location (Zv9):
Chromosome 22 (position 19842020)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 19498713
GRCz11 22 19523691
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTAATTTGACTTTTCTCTTAGCATCTGTGAAGTCTGGCATAGTGAACGGG[A/T]AGGAAGCTAGACCTCATTCAAGACCCTACATGGTTTCTGTTCAATGCAAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link