
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
zgc:113337
- Ensembl ID:
- ENSDARG00000041998
- ZFIN ID:
- ZDB-GENE-050306-20
- Description:
- hypothetical protein LOC503741 [Source:RefSeq peptide;Acc:NP_001013337]
- Human Orthologue:
- CD200
- Human Description:
- CD200 molecule [Source:HGNC Symbol;Acc:7203]
- Mouse Orthologue:
- Cd200
- Mouse Description:
- CD200 antigen Gene [Source:MGI Symbol;Acc:MGI:1196990]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa10701 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa10701
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- C > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000061545 | Nonsense | 202 | 371 | 5 | 9 |
ENSDART00000129207 | Nonsense | 219 | 388 | 3 | 6 |
ENSDART00000132257 | Nonsense | 219 | 388 | 5 | 9 |
- Genomic Location (Zv9):
- Chromosome 9 (position 9564151)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 9 9364702 GRCz11 9 9342739 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- GACACACAGCTCACGCTGTGGCCAGTCCAATCCGAAGATGAGGCCTGCTA[C/A]ACCTGTGAGTTTCACACATACCCGGATGTCATAAAGAGCGCCACCAGCTG
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: