zgc:113337

Ensembl ID:
ENSDARG00000041998
ZFIN ID:
ZDB-GENE-050306-20
Description:
hypothetical protein LOC503741 [Source:RefSeq peptide;Acc:NP_001013337]
Human Orthologue:
CD200
Human Description:
CD200 molecule [Source:HGNC Symbol;Acc:7203]
Mouse Orthologue:
Cd200
Mouse Description:
CD200 antigen Gene [Source:MGI Symbol;Acc:MGI:1196990]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa10701 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa10701
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061545 Nonsense 202 371 5 9
ENSDART00000129207 Nonsense 219 388 3 6
ENSDART00000132257 Nonsense 219 388 5 9
Genomic Location (Zv9):
Chromosome 9 (position 9564151)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 9364702
GRCz11 9 9342739
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GACACACAGCTCACGCTGTGGCCAGTCCAATCCGAAGATGAGGCCTGCTA[C/A]ACCTGTGAGTTTCACACATACCCGGATGTCATAAAGAGCGCCACCAGCTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link