si:dkeyp-7g10.1

Ensembl ID:
ENSDARG00000041982
ZFIN ID:
ZDB-GENE-091113-9
Human Orthologue:
ADAMTS6
Human Description:
ADAM metallopeptidase with thrombospondin type 1 motif, 6 [Source:HGNC Symbol;Acc:222]
Mouse Orthologue:
Adamts6
Mouse Description:
a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 6 Gene [

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14859 Nonsense Available for shipment Available now
sa13308 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa14859
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009715 Nonsense 471 1117 10 24
ENSDART00000138748 Nonsense 470 1116 10 24
Genomic Location (Zv9):
Chromosome 10 (position 11643859)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 11719725
GRCz11 10 11677963
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTTTGACAGCTCAGGTCGGGGAACGTGTCTGGACAATGAGCCTCTAAAA[C/T]GAGACTTCCTGTACCCCACTGTGGCTCCAGGGCAGGTGTACGATGCAGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13308
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009715 Nonsense 908 1117 21 24
ENSDART00000138748 Nonsense 907 1116 21 24
Genomic Location (Zv9):
Chromosome 10 (position 11571183)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 11647049
GRCz11 10 11605287
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAAAGTTAATTCTATACCATGTTGTATTCCAGATGGTTTATCGGCGACTG[G/A]TCAGAATGTGGAAAAACCTGTGATGGAGGGATCCGGAYACGTACTGTTCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Corneal structure: Genome-wide association analyses identify multiple loci associated with central corneal thickness and keratoconus. (View Study)
  • Schizophrenia: Genome-wide association study of clinical dimensions of schizophrenia: polygenic effect on disorganized symptoms. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link