A7MC08_DANRE

Ensembl ID:
ENSDARG00000041960
Description:
Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:A7MC08]
Human Orthologue:
OLFM4
Human Description:
olfactomedin 4 [Source:HGNC Symbol;Acc:17190]
Mouse Orthologues:
E030002O03Rik, Olfm4
Mouse Descriptions:
olfactomedin 4 Gene [Source:MGI Symbol;Acc:MGI:2685142]
RIKEN cDNA E030002O03 gene Gene [Source:MGI Symbol;Acc:MGI:2443346]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa43018 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa43018
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061497 Nonsense 468 470 5 5
Genomic Location (Zv9):
Chromosome 17 (position 53110131)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 52495698
GRCz11 17 52581998
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCTCTACATGTTCAATAATGGCTACTATGTGACTTACAATCTGAAGTTC[A/T]AGGTTGTTTAGGAAGGATCAGTGTGTTCAGGACTGACCGTATGCATGGCG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link