
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
si:dkey-217m5.3
- Ensembl ID:
- ENSDARG00000041919
- ZFIN ID:
- ZDB-GENE-041014-320
- Description:
- hypothetical protein LOC794050 [Source:RefSeq peptide;Acc:NP_001076365]
- Human Orthologues:
- CCL11, CCL13, CCL15, CCL16, CCL2, CCL23, CCL24, CCL26, CCL7, CCL8
- Human Descriptions:
- chemokine (C-C motif) ligand 11 [Source:HGNC Symbol;Acc:10610]
- chemokine (C-C motif) ligand 13 [Source:HGNC Symbol;Acc:10611]
- chemokine (C-C motif) ligand 15 [Source:HGNC Symbol;Acc:10613]
- chemokine (C-C motif) ligand 16 [Source:HGNC Symbol;Acc:10614]
- chemokine (C-C motif) ligand 2 [Source:HGNC Symbol;Acc:10618]
- chemokine (C-C motif) ligand 23 [Source:HGNC Symbol;Acc:10622]
- chemokine (C-C motif) ligand 24 [Source:HGNC Symbol;Acc:10623]
- chemokine (C-C motif) ligand 26 [Source:HGNC Symbol;Acc:10625]
- chemokine (C-C motif) ligand 7 [Source:HGNC Symbol;Acc:10634]
- chemokine (C-C motif) ligand 8 [Source:HGNC Symbol;Acc:10635]
- Mouse Orthologues:
- Ccl11, Ccl12, Ccl2, Ccl24, Ccl26, Ccl6, Ccl7, Ccl8, Ccl9
- Mouse Descriptions:
- chemokine (C-C motif) ligand 11 Gene [Source:MGI Symbol;Acc:MGI:103576]
- chemokine (C-C motif) ligand 12 Gene [Source:MGI Symbol;Acc:MGI:108224]
- chemokine (C-C motif) ligand 2 Gene [Source:MGI Symbol;Acc:MGI:98259]
- chemokine (C-C motif) ligand 24 Gene [Source:MGI Symbol;Acc:MGI:1928953]
- chemokine (C-C motif) ligand 26 Gene [Source:MGI Symbol;Acc:MGI:3589281]
- chemokine (C-C motif) ligand 6 Gene [Source:MGI Symbol;Acc:MGI:98263]
- chemokine (C-C motif) ligand 7 Gene [Source:MGI Symbol;Acc:MGI:99512]
- chemokine (C-C motif) ligand 8 Gene [Source:MGI Symbol;Acc:MGI:101878]
- chemokine (C-C motif) ligand 9 Gene [Source:MGI Symbol;Acc:MGI:104533]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa44948 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa43506 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa44948
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000061434 | Nonsense | 59 | 136 | 3 | 4 |
ENSDART00000142164 | Nonsense | 26 | 103 | 2 | 3 |
- Genomic Location (Zv9):
- Chromosome 20 (position 39357828)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 20 39430240 GRCz11 20 39333119 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ACTTGCAGGTATATTAACAAAAGTTTTACATTTATTTTTCTGCAGGGTCA[C/T]AGGGTCCTGAAAAGTGCTGCTTTTCTTTTACCAATGCAAGAATTCCATTA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa43506
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > T
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000061434 | Essential Splice Site | 94 | 136 | 4 | 4 |
ENSDART00000142164 | Essential Splice Site | 61 | 103 | 3 | 3 |
- Genomic Location (Zv9):
- Chromosome 20 (position 39357634)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 20 39430046 GRCz11 20 39332925 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TGTGATTTGGTTTTGTGAAATAAAGAAAAATCTTTTCTTTTGAAAATGCA[G/T]TTTCATCATAAGGGCTCAAAGGGAGATCTGCACTAATCCAACTGAGAAAT
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Crohn's disease: A genome-wide scan of Ashkenazi Jewish Crohn's disease suggests novel susceptibility loci. (View Study)
- Crohn's disease: Genome-wide meta-analysis increases to 71 the number of confirmed Crohn's disease susceptibility loci. (View Study)
- Hypothyroidism: Novel associations for hypothyroidism include known autoimmune risk loci. (View Study)
- Ulcerative colitis: Host-microbe interactions have shaped the genetic architecture of inflammatory bowel disease. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: