usp39

Ensembl ID:
ENSDARG00000041908
ZFIN ID:
ZDB-GENE-030131-966
Description:
U4/U6.U5 tri-snRNP-associated protein 2 [Source:RefSeq peptide;Acc:NP_001073539]
Human Orthologue:
USP39
Human Description:
ubiquitin specific peptidase 39 [Source:HGNC Symbol;Acc:20071]
Mouse Orthologue:
Usp39
Mouse Description:
ubiquitin specific peptidase 39 Gene [Source:MGI Symbol;Acc:MGI:107622]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa40605 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa40605
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061406 Nonsense 181 497 6 13
Genomic Location (Zv9):
Chromosome 5 (position 71737920)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 68062538
GRCz11 5 68833205
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTGACCTCTTGTTTCTTCTTCTAAGGCGCTGTCGAACGTGCCACCTTTA[C/T]GAAATTACTTTCTCGAGGAGGAAAACTACCGTGGCATTCGCCGTCCACCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link