ankzf1

Ensembl ID:
ENSDARG00000041904
ZFIN ID:
ZDB-GENE-050309-80
Description:
Ankzf1 protein [Source:UniProtKB/TrEMBL;Acc:Q5CZN6]
Human Orthologue:
ANKZF1
Human Description:
ankyrin repeat and zinc finger domain containing 1 [Source:HGNC Symbol;Acc:25527]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa45347 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa45347
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061403 Essential Splice Site None 424 None 11
ENSDART00000122799   None 723 None 15
ENSDART00000124957 Essential Splice Site None 723 None 16
ENSDART00000131385   None 278 None 6
ENSDART00000138398   None 99 None 4
Genomic Location (Zv9):
Chromosome 9 (position 13161337)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 12913902
GRCz11 9 12885105
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCATTTAAACTTAATCGGACTAAAATCATCTGATGGTTCTGGCAAAAAGG[T/C]AAACAAATACATTTTCTCTGATGCCAGCGACGGTCAAATAAGCTGAATAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link